EST details — SGN-E430834

Search information 
Request: 430834Match: SGN-E430834
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279007Clone name: STM-54-K22
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C279007 [STM-54-K22] Trace: SGN-T282970 EST: SGN-E430833 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E430834Length: 263 bp (796 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E430834 [] (trimmed) AAAACGAAGAAAATCACCAATTGAATGGGAGATCGATCACATGTACAAGCACAGATGAAGAAAACCAGATTATTGGATTAAACGAGATATGTGAA
CAAAGTCGAAACATCAGGGATTTCCTTACAAAGAACTATCTGCTTTTGGAGTTGTTTTTATGAAGACATGTCCTGGCATTGTCCTTTTTCTAAAC
ACACGCTGCAGCTATAAGTTCTCTTTACTCGAGTCTTGATTGTTGCAACAACTTTAGTGTCGAATTCATTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E430834] SGN-U297305 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T282971 [Download][View] Facility Assigned ID: STMIF71TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0110 Quality Trim Threshold: 20.5