EST details — SGN-E430234

Search information 
Request: 430234Match: SGN-E430234
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C278652Clone name: STM-53-I4
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C278652 [STM-53-I4] Trace: SGN-T282372 EST: SGN-E430235 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E430234Length: 208 bp (919 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E430234 [] (trimmed) TCTCTCTCTACAATCCCCTTTCTTCTTTCTTCTGAAAATTGTCAACCCACATTTGAAATCCCAAATTCCAAAAGGGGAAAAAACAGGGTTCACTT
TTGATTTCTCTTTCGCCATGTCTATTCGTAGAAGAACCTTGCTTAAAGTTATCGTCCTTGGCGATAGTGGGGTTGGTAAAACGTCATTAATGAAT
CAATATGTACACAAGAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E430234] SGN-U275062 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T282371 [Download][View] Facility Assigned ID: STMIB50TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0017 Quality Trim Threshold: 14.5