EST details — SGN-E427894

Search information 
Request: 427894Match: SGN-E427894
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C277252Clone name: STM-49-E8
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C277252 [STM-49-E8] Trace: SGN-T280030 EST: SGN-E427893 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E427894Length: 364 bp (919 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E427894 [] (trimmed) AATAGATTTATGGAAATTTTAGGGTATTAATATTCCATTGTTGATAGATTATTCACTAAAATAGATTTAGAAGTGCAACTGTCAATATCTTATTT
CTTTTCTCTAAATAAACCAGCATATGTATGCTCCTACTTCTACAAAATGACCTCCAACAACAACTGCGTCTCAGTCCCAAACAAGTAACGTGTCG
GCTCAACAAAATGATCTCCAATTAACAAATTTTATGAGAAAATCTAAATCATAACGCACATTTCTAGTAAGATCGAACAACACTTTAGAAATCTC
GGAAACTCATTTTTGGGTCTTGTTGTTTGGTGCTGCCCCGTCCTCTTCCTCTTCCTCTTCCTCTACCTCGTCCTCTCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E427894] SGN-U283276 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T280031 [Download][View] Facility Assigned ID: STMHL28TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0072 Quality Trim Threshold: 20.5