EST details — SGN-C4210

Search information 
Request: 4210Match: SGN-C4210
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C4210Clone name: cLEC-23-P22
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173683 is on microarray TOM1: SGN-S1-1-8.1.18.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173683 [TUS-16-M9] Trace: SGN-T192898 EST: SGN-E391572 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E206556Length: 451 bp (868 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E206556 [] (trimmed) GAGAAAAAAATAAAAAAATTTCTGCTCTGATCAGTTTCGCTACAGGAATCTTCCTCGTCGCCGGGATCAATTGAAACTCCGTTTCAGGGGAATAC
TGAAGCTTTTCTGAACATTGAGTAGAATTTTGATAACACAACTTGGCATGGGAGTTGTGACTGTTTCAAGCTCTGCATCTCGAAGTCCATTGGGA
TTGAGCTCAAGGTTTTCGGCTCGTTTATGTCCGCTTAAAAGGCCAGGGATTGTATCGTTTAAAAATGATATAACGAAGAATACAACTTTAGTTTC
ACCTAAGGAGTCCATATTCTCGCCTATTGAAACATCGAAGGAAAATGAAAAAAGGTCAAGACGAGTATCTAAGCGTACTGAGAGAGTGCATGCTG
TTACAATCGAAGCCCCTCCAAGTACGTTAGAATTAGACTACAGTGAAGCTGCTGCCAAACTTGAAAGTATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E206556] SGN-U583812 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T28515 [Download][View] Facility Assigned ID: TCADN95TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0156 Quality Trim Threshold: 14.5