EST details — SGN-E399612

Search information 
Request: 399612Match: SGN-E399612
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183688Clone name: TUS-42-N6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183688 is on microarray TOM1 spot ID 1-1-3.2.1.1 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399612Length: 124 bp (998 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E399612 [] (trimmed) CTTGCCCAGGTTTAATGGGAATGATTTGTTGCAGAGATGGTCAGGGAAAAAAATAATGTTTATTGGTGACTCGTTGAGGTTGAACATGTGGAATT
CTCTGGCCTGTATGTTACATGCGTCGGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399612] SGN-U571214 Tomato 200607 Build 2 120 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T200484 [Download][View] Facility Assigned ID: FA0AAD30DG03RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0085 Quality Trim Threshold: 14.5