EST details — SGN-E399380
| Search information |
| Request: 399380 | Match: SGN-E399380 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C183551 | Clone name: TUS-42-H13 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C183551 is on microarray TOM1 spot ID 1-1-4.4.1.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C34321 [cLEG-30-I15] | Trace: SGN-T69177 | EST: SGN-E255451 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C183551 [TUS-42-H13] | Trace: SGN-T199683 | EST: SGN-E398357 | Direction: 3' | Facility: INRA |
| Clone: SGN-C183551 [TUS-42-H13] | Trace: SGN-T200361 | EST: SGN-E399381 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E399380 | Length: 188 bp (998 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E399380 [] (trimmed)
CACATACTTTATAAATTATATTACCTTTATAAAAAACGTGAAAGTATTTAACTCAAACATTTGCTTCAAATTCAAAGGTACAATCTGCAGAAGTA
TAAATATTAATAATAGATAACATTATTATTCTTATTCTTAGATCTTGTAACGGGACAAAGCAAAAGTTCCATCTAGGCCTCTGTTATGGAGGT
TAAATATTAATAATAGATAACATTATTATTCTTATTCTTAGATCTTGTAACGGGACAAAGCAAAAGTTCCATCTAGGCCTCTGTTATGGAGGT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E399380] | SGN-U578448 | Tomato 200607 | Build 2 | 590 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T199683 [Download][View] | Facility Assigned ID: FA0AAD30CD07FM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.938 | Expected Error Rate: 0.0494 | Quality Trim Threshold: 14.5 |
Working
