EST details — SGN-E399161

Search information 
Request: 399161Match: SGN-E399161
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183563Clone name: TUS-42-I1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183563 is on microarray TOM1 spot ID 1-1-8.1.2.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C32421 [cLEG-1-G9] Trace: SGN-T64431 EST: SGN-E248368 Direction: 5' Facility: TIGR
Clone: SGN-C183563 [TUS-42-I1] Trace: SGN-T195490 EST: SGN-E394164 Direction: 5' Facility: INRA
Clone: SGN-C183563 [TUS-42-I1] Trace: SGN-T195956 EST: SGN-E394630 Direction: 3' Facility: INRA
Clone: SGN-C183563 [TUS-42-I1] Trace: SGN-T200243 EST: SGN-E399162 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399161Length: 566 bp (906 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E399161 [] (trimmed) CGTAAATTCATTGTACTGAATTTCATTTCCGATTCGTACGTTTCAAAAATAAAGTACAACCCATAATTCAAAATTCTAACCGAACATCAGAAAAT
TTGAATTCTGAGTACATTATTATTATTACATGCAAGCTTAAGAAGAAAACAGAGCATCTCCATTGGGGGTAAACCTAAACAAGAGCTTGATGTTC
TATTCATCTACATTTTCCTGATGTAACGTCTGAAACTACGAACCAAGTCTAATCCCCCGAACCAGCTAACCTCCGCCTGGTGGCGTTGGAGACTG
ATACCTGACCGAACTTATCCGTCTCGGTTGAAGGTGATCGACCTCGGAGAGGCACATAGTGACGCAACCATACACCAGTGTACACCTGTGCTGGT
CTCATTATCTTGGTATCAGGATCGTCAAGGGACTCACGCCAATGCGCTAAGTAGCCAGCCATGCGAGGGATTGCAAATAATACTGGAAAGAACTC
CGTGGGAAATCCTATTGCCCTGTAGAATAAACCAGAGTAAAAATCGACATTTCGGGGTACAACTTCCTTTCTACAAAGTACTCATCCTGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399161] SGN-U581158 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195956 [Download][View] Facility Assigned ID: FA0AAD30AE01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0185 Quality Trim Threshold: 14.5