EST details — SGN-E399160

Search information 
Request: 399160Match: SGN-E399160
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183537Clone name: TUS-42-G23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183537 is on microarray TOM1 spot ID 1-1-2.3.1.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82140 [cLET-1-A23] Trace: SGN-T102333 EST: SGN-E292059 Direction: 3' Facility: TIGR
Clone: SGN-C82140 [cLET-1-A23] Trace: SGN-T102548 EST: SGN-E292274 Direction: 5' Facility: TIGR
Clone: SGN-C183537 [TUS-42-G23] Trace: SGN-T194938 EST: SGN-E393612 Direction: 5' Facility: INRA
Clone: SGN-C183537 [TUS-42-G23] Trace: SGN-T195955 EST: SGN-E394629 Direction: 5' Facility: INRA
Clone: SGN-C183537 [TUS-42-G23] Trace: SGN-T199570 EST: SGN-E398244 Direction: 3' Facility: INRA
Clone: SGN-C183537 [TUS-42-G23] Trace: SGN-T199670 EST: SGN-E398344 Direction: 3' Facility: INRA
Clone: SGN-C183537 [TUS-42-G23] Trace: SGN-T199670 EST: SGN-E399159 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399160Length: 571 bp (898 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E399160 [] (trimmed) GCTAACAAAGCTAGAGCAAAGCTCATTGTTGTCCTGACACGTGGCGGGAGTACAGCAAAGCTGGTTGCCAAGTATAGGCCTGCAGTTCCTATTCT
GTCAGTAGTCGTGCCTGTTTTGACTACAGACTCTTTCGATTGGTCCATCAGTGACGAGACCCCAGCTAGACACAGTTTGGTATATAGGGGCTTGA
TTCCACTTCTTGGTGAAGGTTCCGCAAAGGCCACTGATTCTGAATCAACTGAGGTAATCCTTGAAGCTTCCCTGAAGTCTGCTGTAACGAAAGGG
CTATGCAAACCTGGTGATGCTGTCGTTGCACTTCATCGTATTGGTTCTGCATCCGTTATCAAGATTTGCATCGTGAAGTAATCGTCATGTCACGT
AACATACAATTCTTGAACTCCCCCACACCTGAGCTCAGACTGATTTTCATTTATGCTTTTCTGGTCTTGATTATGCATTATCAATATGCTGATTA
TGTCACTTTGTGTTAGGATATCTAATATTATCACCAAAGATTACTATATTTCATGTCTGCTTCAAACATTGGGTTTAAAATAAGGATTCGGGGGG
G
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399160] SGN-U565588 Tomato 200607 Build 2 113 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195955 [Download][View] Facility Assigned ID: FA0AAD30AD12RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0022 Quality Trim Threshold: 14.5