EST details — SGN-E399150

Search information 
Request: 399150Match: SGN-E399150
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183519Clone name: TUS-42-G5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183519 is on microarray TOM1 spot ID 1-1-4.3.2.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C5458 [cLEC-31-P18] Trace: SGN-T29644 EST: SGN-E206678 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399150Length: 134 bp (922 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E399150 [] (trimmed) GCTTGTCGTCCTTCAGAGATGGCCCACACCACCAAAGACTGTCCCCTACGACAGTCTCCTGCAGCAAACACCCCCTCCACACTAGTTGAGAAGCG
TCCATAATCAGCCTTGAAGTTGGACCTGTTGTCCTTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399150] SGN-U575484 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T200240 [Download][View] Facility Assigned ID: FA0AAD30AD03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.916 Expected Error Rate: 0.0115 Quality Trim Threshold: 14.5