EST details — SGN-E399118

Search information 
Request: 399118Match: SGN-E399118
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183375Clone name: TUS-42-A5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183375 is on microarray TOM1 spot ID 1-1-4.1.2.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183375 [TUS-42-A5] Trace: SGN-T194905 EST: SGN-E393579 Direction: 5' Facility: INRA
Clone: SGN-C183375 [TUS-42-A5] Trace: SGN-T195468 EST: SGN-E394142 Direction: 3' Facility: INRA
Clone: SGN-C183375 [TUS-42-A5] Trace: SGN-T195469 EST: SGN-E394143 Direction: 3' Facility: INRA
Clone: SGN-C183375 [TUS-42-A5] Trace: SGN-T195470 EST: SGN-E394144 Direction: 5' Facility: INRA
Clone: SGN-C183375 [TUS-42-A5] Trace: SGN-T195470 EST: SGN-E399119 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399118Length: 517 bp (907 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E399118 [] (trimmed) AACAAAAAACGGGTGTTTTAAAAAGGGCTAAAAAAAATTGGAAAAAATTCCAAATTACCCGGATTCTTTTTTTTCCCGGGAACAAATTTTTTATT
ATTTTTACAAAGGGAACCTTTCCCTTTTTCTTTTTCCCAAATCCAAAAATTTTTGAACCCGGAAAAAAAAAAAACCCCCCCAAAACTATGATTTC
GGGGAAAAACAACCCAAAAAAAAAAAACCCCGGCCAAAAACGGGGTTTTAAATCAAAAAAGGCCCCAAAAAACCTTTTTGGACCGGGGAAACCCC
CCTTCAAAAAAAAACCCCACCCCAACCAAAAAAACCCCCTTTGACCCCCCCCCCCTAAGGGCCCAAAATCTTTCCAAAACGCGGGGGAAAATTTT
TTACCCCAAAGACTTCTTTCAAAACCGAGGTATTGAATTTGGGGTTTGGCAAAAACAGGGCCCCCCCCTTGGGCCCCTCCCCCCAAAAAACCGGG
GGGGGGAAAAACCCGGCCCCCTGTACCCCCAATTCCAACCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399118] SGN-U572765 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195468 [Download][View] Facility Assigned ID: FA0AAD30AA03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.808 Expected Error Rate: 0.0259 Quality Trim Threshold: 14.5