EST details — SGN-E399042
| Search information |
| Request: 399042 | Match: SGN-E399042 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C172724 | Clone name: TUS-14-E10 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C172724 is on microarray TOM1 spot ID 1-1-7.1.20.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C10855 [cLEC-6-H18] | Trace: SGN-T24220 | EST: SGN-E202559 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C172724 [TUS-14-E10] | Trace: SGN-T195372 | EST: SGN-E394046 | Direction: 3' | Facility: INRA |
| Clone: SGN-C172724 [TUS-14-E10] | Trace: SGN-T195372 | EST: SGN-E399539 | Direction: 3' | Facility: INRA |
| Clone: SGN-C172724 [TUS-14-E10] | Trace: SGN-T195664 | EST: SGN-E394338 | Direction: 5' | Facility: INRA |
| Clone: SGN-C172724 [TUS-14-E10] | Trace: SGN-T199452 | EST: SGN-E398126 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E399042 | Length: 151 bp (912 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E399042 [] (trimmed)
ATCGTCTTTATTGTAAAATGATTTCTCAATAATGGAGAAATTGTTGAAACTGCGAGTTTTGCTTCTCCTTCTTCTTCTTCTTCAACAACAACAAG
AAGCTAATTCGTATTCTACTGGTGAGTATCTTCCCGGTTGGCAGGGCCGCTCTCCC
AAGCTAATTCGTATTCTACTGGTGAGTATCTTCCCGGTTGGCAGGGCCGCTCTCCC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E399042] | SGN-U583065 | Tomato 200607 | Build 2 | 11 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T200209 [Download][View] | Facility Assigned ID: FA0AAD2BC05RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.924 | Expected Error Rate: 0.0151 | Quality Trim Threshold: 14.5 |


