EST details — SGN-E398619

Search information 
Request: 398619Match: SGN-E398619
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183828Clone name: TUS-43-D2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183828 is on microarray TOM1 spot ID 1-1-7.4.19.16 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C6772 [cLEC-36-K9] Trace: SGN-T31057 EST: SGN-E207469 Direction: 5' Facility: TIGR
Clone: SGN-C183828 [TUS-43-D2] Trace: SGN-T197940 EST: SGN-E396614 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398619Length: 483 bp (903 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E398619 [] (trimmed) AAACACAAACAATGAAAATCAAAAATGTACCTATTTCAAATTTACAAAAGCTATACTTTCCATAAGGCTGTCAAAAAAACAGCACAAATCCTTAT
TTTACATGAACCAATACACTGGGAAAATAGCGGGATCCCCCCCCTGCAACAAAAGTAAAAAAATTTTACAACATAGTAAACAACATACTGGGACA
CATATTTTGAAAACATGTTTGAAAAACTGTGTCCCAAAATCCCCCAGTGAAAGGCCTTTCGAAAATGACAAAATTCAAAAGATTCTTGTTCAACT
TTCCCCCGCAAAAACCACTTCCCCAATACTGGTTGGGCAATGTAAATGAATCAGTTGTAATGTTATTTCCCCCACCCTTTCGGTTCCCGGGGTAA
ATTGCATGGGGTCTATTCCTGAAATCCAAAATCAAATGACCCTACCTAGCTTCCCGGAAAGCAAAAAAATCTGGGGGGGGAATCCCAAAATTTTG
AACCAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398619] SGN-U587817 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199945 [Download][View] Facility Assigned ID: FA0AAD31DB01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.918 Expected Error Rate: 0.0236 Quality Trim Threshold: 14.5