EST details — SGN-E398385
Search information |
Request: 398385 | Match: SGN-E398385 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C180765 | Clone name: TUS-35-D11 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C180765 is on microarray TOM1 spot ID 1-1-6.4.17.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C69226 [cLEN-9-H14] | Trace: SGN-T89188 | EST: SGN-E275316 | Direction: 5' | Facility: TIGR |
Clone: SGN-C180765 [TUS-35-D11] | Trace: SGN-T196371 | EST: SGN-E395045 | Direction: 3' | Facility: INRA |
Sequence |
Sequence Id: SGN-E398385 | Length: 174 bp (926 bp untrimmed) |
Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E398385 [] (trimmed)
TCATATTGAGATTTTTAGAAATTATTCTAATCATTCACAGTGCAAAAGAAGATGGAAAGCCCTAGAGTTGAGGAGAGTTATGACAAAATGAGTGA
ATTAAAAGCGTTTGATGATACTAAGGCCGGTGTTAAAGGACTTGTTGATTCTGGAATTACTATAGTACCTCAAATATTC
ATTAAAAGCGTTTGATGATACTAAGGCCGGTGTTAAAGGACTTGTTGATTCTGGAATTACTATAGTACCTCAAATATTC
Unigenes |
Current Unigene builds | |||||
[SGN-E398385] | SGN-U580508 | Tomato 200607 | Build 2 | 40 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T199711 [Download][View] | Facility Assigned ID: FA0AAD23CB06RM1 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.908 | Expected Error Rate: 0.0072 | Quality Trim Threshold: 14.5 |