EST details — SGN-E398350

Search information 
Request: 398350Match: SGN-E398350
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183514Clone name: TUS-42-F24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183514 is on microarray TOM1 spot ID 1-1-1.2.1.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183514 [TUS-42-F24] Trace: SGN-T194985 EST: SGN-E393659 Direction: 5' Facility: INRA
Clone: SGN-C183514 [TUS-42-F24] Trace: SGN-T199576 EST: SGN-E398250 Direction: 5' Facility: INRA
Clone: SGN-C183514 [TUS-42-F24] Trace: SGN-T199576 EST: SGN-E399461 Direction: 5' Facility: INRA
Clone: SGN-C183514 [TUS-42-F24] Trace: SGN-T199676 EST: SGN-E399460 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398350Length: 522 bp (813 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E398350 [] (trimmed) TTTTTTTGTTTTTTGTCCCCCTCCTTTTTCCTTAACCATTTGGAATCACCATTGAAGAAGAGATGGAGATTGCCTAGAAATGTTCTTCTTTTTTT
TTTTAACTTCTTAATTTTTGAATCTGCCGACAATGATGATATGGACAGAAAAAATTTGGTTAATTCTATTTTTTAAAGATTGTTCTCAGAGGCAG
CATTCATACTTTTTATGGACAGGTACCTGTAAAAGTTTTTTACATTGTCAGTGTATAGTAGTTAAATTCTTCTCTATATCGAGAAATATTTTGTC
AACCCTTTTCATTAGTGAACTTGTTGCGACTTAGGTTCTTCAAGAATTCACACATGGAAAGCAAGAGAAAGTAAGCAAGACTGAGTTTAAAGAAG
TTCTTTCAGATATTTTACTAGGAATGGCTGCTGGTCTAAAGCGAGATCCTATTGTACTCCTTCGTATGGATGGTGAAGATCTTCTTGAGTTCGTT
AAAAGTCCTGCATTCCAACCAGAGATGATTTCCCCGTACTCTGAGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398350] SGN-U578921 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199676 [Download][View] Facility Assigned ID: FA0AAD30DC12FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0048 Quality Trim Threshold: 14.5