EST details — SGN-E398344
| Search information |
| Request: 398344 | Match: SGN-E398344 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C183537 | Clone name: TUS-42-G23 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C183537 is on microarray TOM1 spot ID 1-1-2.3.1.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C82140 [cLET-1-A23] | Trace: SGN-T102333 | EST: SGN-E292059 | Direction: 3' | Facility: TIGR |
| Clone: SGN-C82140 [cLET-1-A23] | Trace: SGN-T102548 | EST: SGN-E292274 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C183537 [TUS-42-G23] | Trace: SGN-T194938 | EST: SGN-E393612 | Direction: 5' | Facility: INRA |
| Clone: SGN-C183537 [TUS-42-G23] | Trace: SGN-T195955 | EST: SGN-E394629 | Direction: 5' | Facility: INRA |
| Clone: SGN-C183537 [TUS-42-G23] | Trace: SGN-T195955 | EST: SGN-E399160 | Direction: 5' | Facility: INRA |
| Clone: SGN-C183537 [TUS-42-G23] | Trace: SGN-T199570 | EST: SGN-E398244 | Direction: 3' | Facility: INRA |
| Clone: SGN-C183537 [TUS-42-G23] | Trace: SGN-T199670 | EST: SGN-E399159 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E398344 | Length: 134 bp (858 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E398344 [] (trimmed)
GCTAACTTAGCTAGAGCAAAGCTCATTGTTGTCCTGACACGTGGCGGGAGTACAGCAAAGCTGGTTGCCAAGTATAGGCCTGCAGTTCCTATTCT
GTCAGTAGTCGTGCCTGTTTTGACTACAGACTCTTTCTA
GTCAGTAGTCGTGCCTGTTTTGACTACAGACTCTTTCTA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E398344] | SGN-U565588 | Tomato 200607 | Build 2 | 113 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T199670 [Download][View] | Facility Assigned ID: FA0AAD30AD12FM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.963 | Expected Error Rate: 0.0090 | Quality Trim Threshold: 14.5 |


