Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E398326

Search information 
Request: 398326Match: SGN-E398326
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183420Clone name: TUS-42-C2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183420 is on microarray TOM1 spot ID 1-1-7.3.2.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C37708 [cLEG-42-O10] Trace: SGN-T72279 EST: SGN-E259518 Direction: 5' Facility: TIGR
Clone: SGN-C183420 [TUS-42-C2] Trace: SGN-T199652 EST: SGN-E399569 Direction: 5' Facility: INRA
Clone: SGN-C183420 [TUS-42-C2] Trace: SGN-T200274 EST: SGN-E399223 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398326Length: 573 bp (856 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E398326 [] (trimmed) AAATAAGCTGCAACATACACACATCCAATAAAGCCCACAAAAAAACTGTAAAATACACTGGGAATTGTGATACACATAGCAACAAAATATATAAG
TTTAAAGTACATATTTCCCAAGTCACATAAGCATAGCCTGGATTTTATTTTCCTCGACAATCGATCACTTTATTCATTCATGTTTTTGATCATGT
AACTTATAATTAAACATCAGTTGGAAGTTCCAACTTGGAATCAAAAGCCGGTTGATTTTCAAGATCACCATATGGACGTTGTCCTCTCCAGTTAC
CTGGGGGATCATAATTACAAGTTATAAAGTACCACCCGTTGTTGCACCTGACCCTAGCACAACCAAAACGTACCGAGTTACCCCACACCACCTGA
GTATAGTGTCCACATACTTTACCAGCTTGACAAGTATTCGAGTTATAATTGTACCATTGCTTCTCGTCAACCCACATCTTCACAGCACCAGCCGC
GTTGAGCTGGGGGAAAGCGGCAGCTAGGTTTTCACCGTAAGGTCCACCAAAGTGTTGCCTCCTGCAGTCCCCAGCTCTTTGATTGGCGTAATTTT
GGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398326] SGN-U579345 Tomato 200607 Build 2 105 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199652 [Download][View] Facility Assigned ID: FA0AAD30BB01RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0107 Quality Trim Threshold: 14.5