Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E398323

Search information 
Request: 398323Match: SGN-E398323
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183588Clone name: TUS-42-J2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183588 is on microarray TOM1 spot ID 1-1-7.2.2.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183588 [TUS-42-J2] Trace: SGN-T194988 EST: SGN-E393662 Direction: 3' Facility: INRA
Clone: SGN-C183588 [TUS-42-J2] Trace: SGN-T194988 EST: SGN-E399471 Direction: 3' Facility: INRA
Clone: SGN-C183588 [TUS-42-J2] Trace: SGN-T194989 EST: SGN-E393663 Direction: 5' Facility: INRA
Clone: SGN-C183588 [TUS-42-J2] Trace: SGN-T195534 EST: SGN-E394208 Direction: 3' Facility: INRA
Clone: SGN-C183588 [TUS-42-J2] Trace: SGN-T199649 EST: SGN-E399472 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398323Length: 635 bp (827 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E398323 [] (trimmed) CTCAAAGACTAATAGAAAGTGAACTTCAACATACTCTCTAAGCTCATCATAAGTTCAAATTTCTTACAAATCCCAAAACAAACAATTCAAATACA
CAAAATAAGGTACTAATTTAAGCAACATACAGTCATTAGAGATTACTTGATAGGTTGTAGACATTAAAAGTTCTTTTGTAAAATTCTCAAACCTC
TTGCTGGGGATTTTATTCTACTGAAGTTCAAGGGACTTCTTGTCATGATGAGGAGGAGGCAATGGATCATAGGAAGAGACTCCTTGGCCTTCCAT
CATATTAAGTTGAAGCATATTTCTTGCTAAATATTGCTGTATTGCACTGTAATCTTGTCCTCCTGCTGCTGGCATCATGCTTAGTTCCTGAAGCC
TCTCATTTTCTGCTATCTTTGATCTAAGGAATGCATTCTCCTGTTCCAGTAGAATTTCCCTCTTCTGCAAATTCTCAGTTTCAGCCAGTATCATC
TCATGCTTTTTTGATCTGATTCTGCTGATGCCTCGTTCAAGTCTATTTTCCAACTGCTTCAGCTCTCTTACGTTCAAACAACTTAATCCTTCACC
AACCAGATGCCTGTTTGAATTCTGCATCATTTGTATCTGTTGGCGCAACTTTTTTTGATTCTTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398323] SGN-U585391 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199649 [Download][View] Facility Assigned ID: FA0AAD30DE01RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0072 Quality Trim Threshold: 14.5