Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E398210

Search information 
Request: 398210Match: SGN-E398210
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182576Clone name: TUS-39-O22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182576 is on microarray TOM1 spot ID 1-1-3.3.7.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398210Length: 272 bp (876 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E398210 [] (trimmed) GAATTGAAACCCAATTTAATTGAAAAACATAACATAACAAGTCATTGTAAATCCAAAATCCTTTGTTCTAAAACAAAAACAGGATTACACCAAAA
CTTAATTTGTCACCCATATTAACTTTATCACTTCTGTTCTTCTCTAATCTCCCTTTCTCCTGAAAGAACAACCCTCGGTGAGTCTAGCACGCCCA
CCAGTTGGCTGGCACAAAACCGTCTGGCAGTTACCGCAAACCACAACAGTCTGCGAGTGGCTGAACACCGTTGTTCTGCACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398210] SGN-U581273 Tomato 200607 Build 2 45 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199536 [Download][View] Facility Assigned ID: FA0AAD27BH11RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.934 Expected Error Rate: 0.0048 Quality Trim Threshold: 14.5