EST details — SGN-E398157

Search information 
Request: 398157Match: SGN-E398157
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183280Clone name: TUS-41-M6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183280 is on microarray TOM1 spot ID 1-1-3.1.3.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C86825 [cLET-44-G18] Trace: SGN-T111440 EST: SGN-E298804 Direction: 5' Facility: TIGR
Clone: SGN-C183280 [TUS-41-M6] Trace: SGN-T196519 EST: SGN-E395193 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398157Length: 178 bp (948 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E398157 [] (trimmed) ATGGTCGCACCCTGGCTGACTACACATCCAGAAGGAGTCTACCCTCCATCTTGTCCTCCGTCTCCTTGGTGGTATGCAGATTTTTGTTAAGACCC
TCACCGGAAAGACCATCACTTTGGAGGTGGAAAGCTCCGACACCTTTGATAATGTTAAGGCTAAGATCCAGGACAAGGAAGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398157] SGN-U577265 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199483 [Download][View] Facility Assigned ID: FA0AAD29BG03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0068 Quality Trim Threshold: 14.5