Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E398156

Search information 
Request: 398156Match: SGN-E398156
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183278Clone name: TUS-41-M4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183278 is on microarray TOM1 spot ID 1-1-5.1.3.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C86064 [cLET-41-N3] Trace: SGN-T110595 EST: SGN-E298558 Direction: 5' Facility: TIGR
Clone: SGN-C183278 [TUS-41-M4] Trace: SGN-T196518 EST: SGN-E395192 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398156Length: 117 bp (984 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E398156 [] (trimmed) GCATCTACAATATATTTGCATTTCTGAAGATTTCAGTTACACAAATGGTATTACTTCCAATGAATTGAAACATAAATCGAAGCTCCAGGAACAGA
CTTAGTGGCGTAAACCCAAGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398156] SGN-U577678 Tomato 200607 Build 2 148 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199482 [Download][View] Facility Assigned ID: FA0AAD29BG02FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.891 Expected Error Rate: 0.0162 Quality Trim Threshold: 14.5