EST details — SGN-E398125

Search information 
Request: 398125Match: SGN-E398125
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172686Clone name: TUS-14-C20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172686 is on microarray TOM1 spot ID 1-1-5.3.20.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10803 [cLEC-6-F12] Trace: SGN-T24212 EST: SGN-E202551 Direction: 5' Facility: TIGR
Clone: SGN-C172686 [TUS-14-C20] Trace: SGN-T195657 EST: SGN-E394331 Direction: 3' Facility: INRA
Clone: SGN-C172686 [TUS-14-C20] Trace: SGN-T195657 EST: SGN-E399031 Direction: 3' Facility: INRA
Clone: SGN-C172686 [TUS-14-C20] Trace: SGN-T195658 EST: SGN-E394332 Direction: 5' Facility: INRA
Clone: SGN-C172686 [TUS-14-C20] Trace: SGN-T195658 EST: SGN-E399032 Direction: 5' Facility: INRA
Clone: SGN-C172686 [TUS-14-C20] Trace: SGN-T199550 EST: SGN-E398224 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398125Length: 351 bp (848 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E398125 [] (trimmed) ATATTAAAACAAAGTACTCCATATATATATATATATATATATATATATATATATATATATAGTTAAAATACATGCACCAAACATTATAAGGTAAA
TCCAAGATTTAGAAAAGCATAAACAACAGCACAAGAGCGCGAACACTAATACTATTACAATTGCATGCTAAGGCACGCAACTTATTATTATTATC
ATCATATGTACTCTCTAATCTCTATTACTACTATTACTACTACTACACCCAAAAGCTAATTAATAAACTACTCAGCCATAAAATACTCCCGAAAT
AACACTTTGATCATGTTCCGTAAAACTGATGATGGGGTGAAGCAAAGTCTTCCATCTGATAAACAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398125] SGN-U578439 Tomato 200607 Build 2 74 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199451 [Download][View] Facility Assigned ID: FA0AAD2BB10FM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.859 Expected Error Rate: 0.0090 Quality Trim Threshold: 14.5