EST details — SGN-E397923

Search information 
Request: 397923Match: SGN-E397923
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181203Clone name: TUS-36-F17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181203 is on microarray TOM1 spot ID 1-1-8.2.14.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17257 [cLED-19-C14] Trace: SGN-T53567 EST: SGN-E237653 Direction: 5' Facility: TIGR
Clone: SGN-C181203 [TUS-36-F17] Trace: SGN-T193986 EST: SGN-E392660 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397923Length: 606 bp (845 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E397923 [] (trimmed) GTATACTATATGCTACATATATAATCTTCAAAAAAAGAAATATCAAAATCACACCAAAGCTAAAACTATTCCCTATGACACTATTTAACTACTAA
CAACAAATGATTAAATATACCTAACTAGAAAAAAAGAAAATATGCCACTTTCTTTGTGTGTGCATTTATAGTAAAACTAACTTTGTGAATGAAAA
AGTTCCTCCCTCACACATAATCCCACATTTCCAAAGCACATAATTGATTTTGTCCCACTTGTCAAAAATGGTACACTAACCACAAAGTAAAATAG
AAAAACCTTCTTGTCCATCAATCTATTATTTGCATTACTTTGTTCTTGAACAAACTTTTGTTCAACATTCTGTTCTTTCTAATGCTTGTTGTTGC
TGTTGTTGGTTGATTATTTGCATTAGTATCTCTCCGGCCTTCATATTCGAACCCGGAGTTTCCATAATGGGCAATTGTTTCTTGGACTTGTTTTG
ATAGATGGAATCCAATTGATGAAAATATGGACATGTTTTTGAATCTTCTGGCCTTTTCTTTTTGGCTTTCTTTAACTCTTCTATAGTACTTGGTT
TATGTTCTCCCCTTTTCTCTTTACATCTCTTTCGCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397923] SGN-U572185 Tomato 200607 Build 2 37 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199249 [Download][View] Facility Assigned ID: FA0AAD24CC09FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.921 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5