EST details — SGN-E397843

Search information 
Request: 397843Match: SGN-E397843
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180497Clone name: TUS-34-I7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180497 is on microarray TOM1 spot ID 1-1-2.1.19.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C26860 [cLEF-41-M3] Trace: SGN-T60241 EST: SGN-E246826 Direction: 5' Facility: TIGR
Clone: SGN-C180497 [TUS-34-I7] Trace: SGN-T193493 EST: SGN-E392167 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397843Length: 204 bp (879 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E397843 [] (trimmed) AAACTAAGTGGTTGTTTGCTGCCGTCTACATATGTAACAGGTGAGTAGCTTTGGCTCAATCCTATCATGTGGCTGGACTGTTATGCAATTGATTT
TGGTTCTATAATTGAGGGGTTATCTAATGCCATTTTTTGTTGGAGACGTAGTCACTGGTTGACACTGCTTTTTTATAGGAGAAAGTTATTTGACT
TATGAAATGAATTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397843] SGN-U596285 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199169 [Download][View] Facility Assigned ID: FA0AAD22AE04RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0008 Quality Trim Threshold: 14.5