EST details — SGN-E397746

Search information 
Request: 397746Match: SGN-E397746
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185210Clone name: TUS-46-M16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185210 is on microarray TOM1 spot ID 1-1-1.1.12.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C37336 [cLEG-41-M11] Trace: SGN-T71890 EST: SGN-E258858 Direction: 5' Facility: TIGR
Clone: SGN-C185210 [TUS-46-M16] Trace: SGN-T1880 EST: SGN-E378475 Direction: 5' Facility: Giov. Lab
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397746Length: 274 bp (864 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E397746 [] (trimmed) TTCTTTCACAATTTTGGTTGTTTCAGTAGGAGAGAAAAGAGGATCTAAGAGTTAGCCAAGAGAAGAAATTAGTGAGAAAATAAAGTAGAAAAAGA
TCATCAGAGGAAGGAGGGATGGGTAGAGGAAGAGTTGAGCTGAAGAGGATAGAAAACAAGATAAATAGACAAGTCACTTTTGCAAAGAGGAGAAA
TGGATTGCTCAAAGAAGCTTATGAACTATCTGTGCTTTGTGATGCTGAAGTTGCTCTACTCGTTTTCTCTAATCGTGGAAAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397746] SGN-U581481 Tomato 200607 Build 2 89 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199072 [Download][View] Facility Assigned ID: FA0AAD34BG08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.900 Expected Error Rate: 0.0030 Quality Trim Threshold: 14.5