EST details — SGN-E397428

Search information 
Request: 397428Match: SGN-E397428
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184891Clone name: TUS-45-P9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184891 is on microarray TOM1 spot ID 1-1-8.4.14.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C103075 [cLHT-35-L13] Trace: SGN-T172068 EST: SGN-E358422 Direction: 5' Facility: TIGR
Clone: SGN-C184891 [TUS-45-P9] Trace: SGN-T200053 EST: SGN-E398727 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397428Length: 199 bp (880 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E397428 [] (trimmed) GCAAAATATGAAGTCCTTTCCAAGAGTATCCTCCTCTCGCCGGAAGAGCAGGAAGGCTCATTTCACGGCGCCTTCAAGTGCGCGCCGGATTTTAA
TGAGCGCACCCTTATCGTCCGAGTTACGTGTAAAGTACAACGTAAGATCTATGCCGGTGAGGAAAGATGACGAAGTTCACGTTGTAATGAGTTAT
TTACTAGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397428] SGN-U579485 Tomato 200607 Build 2 53 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198754 [Download][View] Facility Assigned ID: FA0AAD33CH05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0033 Quality Trim Threshold: 14.5