Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E397378

Search information 
Request: 397378Match: SGN-E397378
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184739Clone name: TUS-45-J1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184739 is on microarray TOM1 spot ID 1-1-8.2.14.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C81361 [cLET-15-P19] Trace: SGN-T106546 EST: SGN-E293595 Direction: 5' Facility: TIGR
Clone: SGN-C81361 [cLET-15-P19] Trace: SGN-T106547 EST: SGN-E293596 Direction: 3' Facility: TIGR
Clone: SGN-C184739 [TUS-45-J1] Trace: SGN-T198705 EST: SGN-E397379 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397378Length: 339 bp (856 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E397378 [] (trimmed) GATTACAACCGATAATATGTGATCCATGATACTACATTCACTCAAATGTCTTAAATTTGAGGATGAGAGTCAAATCGAATGTACTTTCAAACGAC
GACATGACTTGTGTCCACTCTCTCTGATACCGTAAATTTCAGTACAAAAGATGAATCGATGAAGGCTAAGGTATTTCATGATGCATTGATAGCAG
CCTGGATTTGTTCCAAAGTTCTTCCTTTGGTTTCAGGTACTATTTTTATCACAAATAATATGGACAGTGCTTTCACTGCCTCTTACAAAACGAAC
GTACCACCACAATTCTTTGTCATGATGAAGGCCAATAGAGAACGAGCCCGACCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397378] SGN-U595413 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198704 [Download][View] Facility Assigned ID: FA0AAD33CE01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.929 Expected Error Rate: 0.0292 Quality Trim Threshold: 14.5