EST details — SGN-E397360
| Search information |
| Request: 397360 | Match: SGN-E397360 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C184661 | Clone name: TUS-45-F19 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C184661 is on microarray TOM1 spot ID 1-1-6.2.14.16 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C78716 [cLES-6-I23] | Trace: SGN-T98393 | EST: SGN-E286941 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C184661 [TUS-45-F19] | Trace: SGN-T200042 | EST: SGN-E398716 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E397360 | Length: 156 bp (951 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E397360 [] (trimmed)
GAACTACATACGTTCTTTTTCTTAAAGATGTTCCCGGGACCCATGAATTCCTCCTCCTTGACGAAGGAAAATGGGAACATGTTAAGGATACAACA
GAAATCGGAGAAGGAAAGATGTTCTCCCCTGGGAGTTGGAAGCCTCCATTGACTCTCCAGA
GAAATCGGAGAAGGAAAGATGTTCTCCCCTGGGAGTTGGAAGCCTCCATTGACTCTCCAGA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E397360] | SGN-U574431 | Tomato 200607 | Build 2 | 42 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T198686 [Download][View] | Facility Assigned ID: FA0AAD33CC10RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.925 | Expected Error Rate: 0.0115 | Quality Trim Threshold: 14.5 |
Working
