EST details — SGN-E397309
| Search information |
| Request: 397309 | Match: SGN-E397309 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C184826 | Clone name: TUS-45-M16 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C184826 is on microarray TOM1 spot ID 1-1-1.1.14.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C85745 [cLET-40-G1] | Trace: SGN-T110303 | EST: SGN-E295070 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C184826 [TUS-45-M16] | Trace: SGN-T196569 | EST: SGN-E395243 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E397309 | Length: 156 bp (931 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E397309 [] (trimmed)
AATATTAAAACAAATGCCCTTAATTCAAAAAATGAAGGGAACACAACAAAGTAAAATTACTACCGTTTCCCCAAAAAAAAACTTTAAGGAGGATT
CCAACAACCTTCCCCTAAATACATAGGGTCAATTATACATTACATAATTAAAAATTGGCAT
CCAACAACCTTCCCCTAAATACATAGGGTCAATTATACATTACATAATTAAAAATTGGCAT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E397309] | SGN-U578438 | Tomato 200607 | Build 2 | 819 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T198635 [Download][View] | Facility Assigned ID: FA0AAD33BG08FM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.803 | Expected Error Rate: 0.0122 | Quality Trim Threshold: 14.5 |
Working
