Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E397304

Search information 
Request: 397304Match: SGN-E397304
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184780Clone name: TUS-45-K18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184780 is on microarray TOM1 spot ID 1-1-7.3.14.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C84478 [cLET-28-P16] Trace: SGN-T109335 EST: SGN-E297541 Direction: 5' Facility: TIGR
Clone: SGN-C184780 [TUS-45-K18] Trace: SGN-T196566 EST: SGN-E395240 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397304Length: 175 bp (990 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E397304 [] (trimmed) AGCATTAGCAAGTCTATGAGTATCTTATTTAATTGTACTCTTAAGATTAAACATAAACTGGTAGAAGCAACACAACAACCAATTACGGTTAACCC
TAGAACTCAACCCGACACGACCCGACCAAAGCAGTATAGATAGTTTGAAATTAAAAACAAAGCCTATAACGGCGACTCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397304] SGN-U577630 Tomato 200607 Build 2 444 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198630 [Download][View] Facility Assigned ID: FA0AAD33BF09FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.902 Expected Error Rate: 0.0148 Quality Trim Threshold: 14.5