EST details — SGN-E397290
Search information |
Request: 397290 | Match: SGN-E397290 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C184640 | Clone name: TUS-45-E22 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C184640 is on microarray TOM1 spot ID 1-1-3.1.14.16 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C83292 [cLET-24-A24] | Trace: SGN-T108612 | EST: SGN-E296095 | Direction: 5' | Facility: TIGR |
Clone: SGN-C184640 [TUS-45-E22] | Trace: SGN-T196549 | EST: SGN-E395223 | Direction: 5' | Facility: INRA |
Sequence |
Sequence Id: SGN-E397290 | Length: 153 bp (945 bp untrimmed) |
Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E397290 [] (trimmed)
AAGCAACAAAATCGAGATTAGCATTAGCAAGTCTATGAGTATCTTATTTAATTGTAGTCTTAAGATTAAACATAAACTGGTAGAAGCAACACAAC
AACCAATTACGGTTAACCCTAGAACTCGACCCGACACGACCCGACCAAAGCAGTAGAG
AACCAATTACGGTTAACCCTAGAACTCGACCCGACACGACCCGACCAAAGCAGTAGAG
Unigenes |
Current Unigene builds | |||||
[SGN-E397290] | SGN-U577630 | Tomato 200607 | Build 2 | 444 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T198616 [Download][View] | Facility Assigned ID: FA0AAD33BC11FM1 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.927 | Expected Error Rate: 0.0025 | Quality Trim Threshold: 14.5 |