EST details — SGN-E397205

Search information 
Request: 397205Match: SGN-E397205
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184504Clone name: TUS-44-P6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184504 is on microarray TOM1 spot ID 1-1-3.4.16.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184504 [TUS-44-P6] Trace: SGN-T198532 EST: SGN-E397206 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397205Length: 506 bp (861 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E397205 [] (trimmed) TATTCTCGAGCATTTCGATACCTTCATAATTCGGTGTCAAGGTGGCTTTTGATTCTTTGAAATCGTGCGGTAAATCAAGCTTATCGAACTACAAG
TGGCCTGAATTCGGCCGATTTCGAAGTGAAGCTATAAACCTGCATCCACAGAAAAATTGTCAGTTTTAAACATACTGATCTGTGTCGATCCCTTC
GATTGTTTGCTCCTTGTCTTGACGTCCTCGGTTGATTTCCCGATTTCTCGACTCTTGATAGATAAGAAAATATCTTATGCCAAAACAGATGAAAT
ATAAAAGGGAAATTTTTAAGAGAAGCAAGAAATTTTTTAAGAAATAGTATCTCGAAAAAGTCAATGCCAAGTCATGTCATGTCAGGCTTAACGAG
CTTCTTTGAGTCCGACGCTTGTCGAATGAATTTCAGAGGCATTCCAGACTTGTGGGGAAGTCCCATGACGAAATTTTGAGGCCATCCTCAAAATT
TCTGTCCCAGTTTAGTATCTTGTTCATCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397205] SGN-U572461 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198531 [Download][View] Facility Assigned ID: FA0AAD32DH03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0011 Quality Trim Threshold: 14.5