EST details — SGN-E397044

Search information 
Request: 397044Match: SGN-E397044
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184226Clone name: TUS-44-D16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184226 is on microarray TOM1 spot ID 1-1-1.4.16.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77110 [cLES-1-O5] Trace: SGN-T97456 EST: SGN-E283780 Direction: 5' Facility: TIGR
Clone: SGN-C77110 [cLES-1-O5] Trace: SGN-T97457 EST: SGN-E283781 Direction: 3' Facility: TIGR
Clone: SGN-C184226 [TUS-44-D16] Trace: SGN-T199991 EST: SGN-E398665 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397044Length: 367 bp (873 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E397044 [] (trimmed) GTCGGACCCTAGTTTCTTCACCCCACAATCTCCGTCGAACTGGCGATGATCGATAACATCGATGATATCATCAACTGGGACGATGTAGATCACAT
CTTCCACAACGTTCTAGACAATCCCGACGATGATCAATTCACTCTTCATGATTCCTCCCCACAGTCATTCCAGCAGATCGAGCAGCTTCTTATGA
ACGATGACGATTTCGGTCTTGTCTCTGATCCTCAGTTTGCTGCCGAATCTCTTTCTGACTTCCTCGTCGATTCTCCTCTTCACTCCGATCATTCT
CACTCTCCTGCTGAACAAGCCATTGGATTCTCCGATCCCAAGGTTTCAAGTGCCGATCACGACAAACACAAGGTTTCCCAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397044] SGN-U580933 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198370 [Download][View] Facility Assigned ID: FA0AAD32DB08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0062 Quality Trim Threshold: 14.5