EST details — SGN-E397028

Search information 
Request: 397028Match: SGN-E397028
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184176Clone name: TUS-44-B14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184176 is on microarray TOM1 spot ID 1-1-3.2.16.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C71805 [cLER-19-D10] Trace: SGN-T96489 EST: SGN-E284917 Direction: 5' Facility: TIGR
Clone: SGN-C184176 [TUS-44-B14] Trace: SGN-T198353 EST: SGN-E397027 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397028Length: 250 bp (875 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E397028 [] (trimmed) TTATAAGTTTAGTTAATCGTCTAAATGAATGTGGTAACACATAAAAGAAATAGAAATGATGTTACATTTTAAAAACCACTAATTCTTTGATAACT
ACAGAGATGATTGAGTCCAATTTTCAAAGATCCACAAATCCCTATAGTTAGCATACCCTACTTCACTAGCACATTTGTAAATACTCCAATACATT
TCCTTTAGGCTGGGGTCAACTGATGGTATTCCCATTTGAGCTGCTGGGGGGGGCCCGGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397028] SGN-U583248 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198354 [Download][View] Facility Assigned ID: FA0AAD32DA07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.927 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5