EST details — SGN-E397028
| Search information |
| Request: 397028 | Match: SGN-E397028 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C184176 | Clone name: TUS-44-B14 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C184176 is on microarray TOM1 spot ID 1-1-3.2.16.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C71805 [cLER-19-D10] | Trace: SGN-T96489 | EST: SGN-E284917 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C184176 [TUS-44-B14] | Trace: SGN-T198353 | EST: SGN-E397027 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E397028 | Length: 250 bp (875 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E397028 [] (trimmed)
TTATAAGTTTAGTTAATCGTCTAAATGAATGTGGTAACACATAAAAGAAATAGAAATGATGTTACATTTTAAAAACCACTAATTCTTTGATAACT
ACAGAGATGATTGAGTCCAATTTTCAAAGATCCACAAATCCCTATAGTTAGCATACCCTACTTCACTAGCACATTTGTAAATACTCCAATACATT
TCCTTTAGGCTGGGGTCAACTGATGGTATTCCCATTTGAGCTGCTGGGGGGGGCCCGGTA
ACAGAGATGATTGAGTCCAATTTTCAAAGATCCACAAATCCCTATAGTTAGCATACCCTACTTCACTAGCACATTTGTAAATACTCCAATACATT
TCCTTTAGGCTGGGGTCAACTGATGGTATTCCCATTTGAGCTGCTGGGGGGGGCCCGGTA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E397028] | SGN-U583248 | Tomato 200607 | Build 2 | 4 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T198354 [Download][View] | Facility Assigned ID: FA0AAD32DA07RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.927 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 12.5 |


