EST details — SGN-E396854

Search information 
Request: 396854Match: SGN-E396854
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184340Clone name: TUS-44-I10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184340 is on microarray TOM1 spot ID 1-1-7.1.16.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C19957 [cLED-28-L20] Trace: SGN-T56030 EST: SGN-E241552 Direction: 5' Facility: TIGR
Clone: SGN-C184340 [TUS-44-I10] Trace: SGN-T198179 EST: SGN-E396853 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396854Length: 384 bp (902 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E396854 [] (trimmed) TTTTTTTTTATAAACTTGTGCTTCCCATTCAAGAACACTAGTGATACTCAATATTCAAGAAATTAAAACAACATTTTTTTCTTCTCAATGGAGGG
ATTATGTGTAAAGCTTTTTGAAGCATCAAGGTAATTAATAATTTTTCTATATATTTCGATCCATTTTATTTGCTATATTATTACTATATAATATT
CTTTTGATGAAATTAAATTATTTTTTTCTAAAGAAAGTACAAAATGAAGAGACATAAAGCTGAAGCAATAGGAATGGTAGTAGATAGTTTTGAGG
CAAGTCATGAAGGGATCAAAACTATTGATATCCAAAAACGTTGTGAATTCTCTGGAACTTCTCATCTTTGCATCTATTTCGTCACTTGGAATATG
AACG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396854] SGN-U571525 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198180 [Download][View] Facility Assigned ID: FA0AAD32BE05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.907 Expected Error Rate: 0.0008 Quality Trim Threshold: 14.5