EST details — SGN-E396767

Search information 
Request: 396767Match: SGN-E396767
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183836Clone name: TUS-43-D10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183836 is on microarray TOM1 spot ID 1-1-7.4.19.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C6930 [cLEC-37-E5] Trace: SGN-T31151 EST: SGN-E208160 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396767Length: 146 bp (884 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E396767 [] (trimmed) CAGACTCGTCCCGAGTTGTTTGCATAACCTTCAATTGTTACAACAAGTATTATGCCTCATGACTTATTCCTTATTATTGCCTCTGATGGCCTCTG
GGAACAAATAAATGATCAATCATCTGTGGAGATGGTATTTAAAAACACTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396767] SGN-U579183 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198093 [Download][View] Facility Assigned ID: FA0AAD31DB05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0518 Quality Trim Threshold: 14.5