Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E396467

Search information 
Request: 396467Match: SGN-E396467
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185992Clone name: TUS-48-N6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185992 is on microarray TOM1 spot ID 1-1-3.2.7.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C69745 [cLER-12-H19] Trace: SGN-T94507 EST: SGN-E283540 Direction: 5' Facility: TIGR
Clone: SGN-C185992 [TUS-48-N6] Trace: SGN-T192437 EST: SGN-E391111 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396467Length: 322 bp (887 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E396467 [] (trimmed) CGGGCAGGTACTCAGCACCACCAACAAGAACAACCTCTGCGACGACAGCAAGAATAAGGTTGATGGGAATGTTCTTTCCGAAGTAATTCAATGTG
TTTCCGTCTAGAAGTAAAGCTCCAGTCTTGAACCAAACAGCTTCAGGACCACAGTTGGCACCAAATTTGTTGAAGGCTTCTGGGATAATAAACCC
AGCAGCACCGAGCATAGCCCATCTGGCGTGGATCAGCTCATATGCCTGATATTTGGCGAAGTCTTCTGGCTTCTTGCTCAAACCAAAAGGATCGT
AACCGTAGTCTCCGGGAACTTCTCCGTTCAAGTACCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396467] SGN-U580870 Tomato 200607 Build 2 302 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197793 [Download][View] Facility Assigned ID: FA0AAD36DG03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.995 Expected Error Rate: 1.0000 Quality Trim Threshold: 14.5