EST details — SGN-E396427

Search information 
Request: 396427Match: SGN-E396427
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185709Clone name: TUS-48-B11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185709 is on microarray TOM1 spot ID 1-1-6.2.7.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185709 [TUS-48-B11] Trace: SGN-T192697 EST: SGN-E391371 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396427Length: 239 bp (923 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E396427 [] (trimmed) AGGTACCCTGATCTTCGTATTCGCAGGTCAGGGTTCTGGTATGGCTTTCAATAAGCTTACCGATGGCGTCGCTACTCCCGCTGGCCTTATTTCCG
CCTCCATAGCACACGCCTTCGGGTTGTTCGTCGCCGTCTCCGTCGGTGCTAACATCTCCGGCGGCCACGTCAACCCTGCTGTTACCTTCGGTGCT
TTTGTTGGTGGAAACATCACTTTGTTCCGTGGAATTTTGTACCTGCCCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396427] SGN-U581024 Tomato 200607 Build 2 145 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197753 [Download][View] Facility Assigned ID: FA0AAD36CA06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 1.0000 Quality Trim Threshold: 14.5