EST details — SGN-E396331

Search information 
Request: 396331Match: SGN-E396331
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185192Clone name: TUS-46-L22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185192 is on microarray TOM1 spot ID 1-1-3.4.11.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C93166 [cLEX-13-O11] Trace: SGN-T117388 EST: SGN-E306295 Direction: 5' Facility: TIGR
Clone: SGN-C185192 [TUS-46-L22] Trace: SGN-T192030 EST: SGN-E390704 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396331Length: 222 bp (853 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E396331 [] (trimmed) TCAAAACCTTTTACAACCTGGTTCTAATTTTGTCTTCCCTATACACACTCTTAGCTCCAAACAAACTGAACTGTTTTNTGTCCTGGAAAACTCCA
AGACATCCCCACGTGTGGCATATATCCAAGCTTCTGGTCTTTTCCCACCGGCTCTCTTCCTGTTTTTATTTTATCTTACCTACCTTCTTCCCCCT
ATCTCATTTCACCCTTTTTCTTTCAGTCTTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396331] SGN-U601514 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197657 [Download][View] Facility Assigned ID: FA0AAD34DF11FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.926 Expected Error Rate: 0.0240 Quality Trim Threshold: 20.5