EST details — SGN-E396240

Search information 
Request: 396240Match: SGN-E396240
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183275Clone name: TUS-41-M1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183275 is on microarray TOM1 spot ID 1-1-8.1.3.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C81860 [cLET-18-J23] Trace: SGN-T107213 EST: SGN-E293388 Direction: 5' Facility: TIGR
Clone: SGN-C183275 [TUS-41-M1] Trace: SGN-T191512 EST: SGN-E390186 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396240Length: 520 bp (878 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E396240 [] (trimmed) ACAGTGAAGAAAAGACTAGTTCTATATCAAATGTGAAAATTTGCTTCATACACAAATGCACAAAAGTGTTTTTTAACTTTCTTATAGTCTATATA
TTGTTTATACTCTAGATCAAATTAGGGGGATAAGTGTATGTGAATTGTACAAGTTGCAGTATATGTTCAAGCTATTATACAGCTGCTGGGGTAGG
AACAGCAGCAGGGACGCGGTTTTCAGCAGGAATTTCAACAAATTCTGAGAGAATAGCACGGAATTCATCTCCAGTCATCGTCTCCTTTTCAAGGA
GGACTTCCACAATCTTATCAATTGCTTCACGGTTGCTGCGGATTTGGCTCAATGCAATCTCATATGCACTGTCTGAAAGCTTCTTCACAGCAACA
TCAATGTCTTCAGCTAGCTTTTCTGACATCGAGTTCCTGGCCATCATTCTCATGATTACATCACCACTTTGGGCTGAAGAATCCATGAGGGACCA
CGGGCCAAGTTCAGACATACCAAAAGTGACAACCATCTGTTTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396240] SGN-U565008 Tomato 200607 Build 2 66 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197566 [Download][View] Facility Assigned ID: FA0AAD29AG01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5