EST details — SGN-E396031

Search information 
Request: 396031Match: SGN-E396031
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174424Clone name: TUS-18-L6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174424 is on microarray TOM1 spot ID 1-1-3.4.16.15 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C23027 [cLED-4-E4] Trace: SGN-T49236 EST: SGN-E231467 Direction: 5' Facility: TIGR
Clone: SGN-C174424 [TUS-18-L6] Trace: SGN-T197358 EST: SGN-E396032 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396031Length: 424 bp (840 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E396031 [] (trimmed) AGGGAATTTTGCAACTTTACTCTTCCCAAAAAAATCATAACAATAATGTGTAGGGTAATCAATTTCAAGTACTCCATTATACAACTTAAAAAAAG
GGAAAAATAGGCATATAAGTCACCCTCTAGTAAATATGTCAAAGTAAAAAAGTTAACTTTAATCATCATCCATTAAAAACAAAAACAAGGATGAA
TAATTATTATTTTTATTGAAACTAATTTTGCAGGTTCCTCTGGTGCAAAAACAAGGCTTTTCCACAAATACCACGATAATCCCTAAAAAAAATTC
AGGGTAACTTTTTGTTGTCCACAAATCTTGTGGGGTGCTGGAAGGTCAAAAATTTCATTCCCTTTTGTGTTTTTCTTGAAACCACCTATATTGTC
CCCCAAATGTTTCTTTTCCTCCAACAGCAGTTTTTCCTTCTCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396031] SGN-U580461 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197357 [Download][View] Facility Assigned ID: FA0AAD6DF03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.876 Expected Error Rate: 0.0162 Quality Trim Threshold: 14.5