EST details — SGN-E394891

Search information 
Request: 394891Match: SGN-E394891
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183855Clone name: TUS-43-E5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183855 is on microarray TOM1 spot ID 1-1-4.1.19.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C9381 [cLEC-5-L16] Trace: SGN-T23773 EST: SGN-E200938 Direction: 5' Facility: TIGR
Clone: SGN-C183855 [TUS-43-E5] Trace: SGN-T1786 EST: SGN-E378806 Direction: 5' Facility: Giov. Lab
Clone: SGN-C183855 [TUS-43-E5] Trace: SGN-T199686 EST: SGN-E398360 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394891Length: 120 bp (886 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394891 [] (trimmed) GTCAAGTTCCATTAATTGCTTATTTACTCATCATCACATTCATTAGCGCTGTAGTTTTATTTTGTAATGCATCCTTCTTTAGGGGTTAGCAAAAG
GAAAATGGCTTTCTTTTCCCCTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394891] SGN-U566445 Tomato 200607 Build 2 42 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196217 [Download][View] Facility Assigned ID: FA0AAD31AC03RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.788 Expected Error Rate: 0.0012 Quality Trim Threshold: 12.5