EST details — SGN-E394891
Search information |
Request: 394891 | Match: SGN-E394891 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C183855 | Clone name: TUS-43-E5 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C183855 is on microarray TOM1 spot ID 1-1-4.1.19.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C9381 [cLEC-5-L16] | Trace: SGN-T23773 | EST: SGN-E200938 | Direction: 5' | Facility: TIGR |
Clone: SGN-C183855 [TUS-43-E5] | Trace: SGN-T1786 | EST: SGN-E378806 | Direction: 5' | Facility: Giov. Lab |
Clone: SGN-C183855 [TUS-43-E5] | Trace: SGN-T199686 | EST: SGN-E398360 | Direction: 3' | Facility: INRA |
Sequence |
Sequence Id: SGN-E394891 | Length: 120 bp (886 bp untrimmed) |
Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E394891 [] (trimmed)
GTCAAGTTCCATTAATTGCTTATTTACTCATCATCACATTCATTAGCGCTGTAGTTTTATTTTGTAATGCATCCTTCTTTAGGGGTTAGCAAAAG
GAAAATGGCTTTCTTTTCCCCTTTT
GAAAATGGCTTTCTTTTCCCCTTTT
Unigenes |
Current Unigene builds | |||||
[SGN-E394891] | SGN-U566445 | Tomato 200607 | Build 2 | 42 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T196217 [Download][View] | Facility Assigned ID: FA0AAD31AC03RM1 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.788 | Expected Error Rate: 0.0012 | Quality Trim Threshold: 12.5 |