EST details — SGN-E394862

Search information 
Request: 394862Match: SGN-E394862
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183411Clone name: TUS-42-B17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183411 is on microarray TOM1 spot ID 1-1-8.2.1.6 [Order] [Tomato Microarray Database]
See unigene SGN-U578195 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C32360 [cLEG-1-A5] Trace: SGN-T64417 EST: SGN-E248354 Direction: 5' Facility: TIGR
Clone: SGN-C183411 [TUS-42-B17] Trace: SGN-T196066 EST: SGN-E394740 Direction: 5' Facility: INRA
Clone: SGN-C183411 [TUS-42-B17] Trace: SGN-T196066 EST: SGN-E399340 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394862Length: 343 bp (874 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E394862 [] (trimmed) CTGTAAATTATTTGTGCATATATTTGCTGAGCTTTCTTAGTTTACATAGAATCCAGGTAAGCTCTACTCGGTTTCCAGGAACCCATACATTGTAT
ACTCTACTAGATTTGACATTGCTAGATGACATCTAATCCTAAGGTAGGGCGAATAACACTACATATATTGATCTCCCTCTTCCCTTTCTTGATGG
GACGTCGGTGAAATAACCTTCAAATGAAAAAGAAAAAAAAAACGAAATAAAGAAGATTACAAGTCTTGCAAAGGGAAGGATTGAATATTAGCTGA
CTCAAGTGACCAAATCTTGAGGGAGGAACTAGCGCTAGCCCCTGTGGCATTGTTTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394862] SGN-U578195 Tomato 200607 Build 2 342 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196188 [Download][View] Facility Assigned ID: FA0AAD30CA09FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0009 Quality Trim Threshold: 14.5