EST details — SGN-E394759

Search information 
Request: 394759Match: SGN-E394759
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183545Clone name: TUS-42-H7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183545 is on microarray TOM1 spot ID 1-1-2.4.2.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C34286 [cLEG-30-G19] Trace: SGN-T69175 EST: SGN-E255449 Direction: 5' Facility: TIGR
Clone: SGN-C183545 [TUS-42-H7] Trace: SGN-T196084 EST: SGN-E394758 Direction: 3' Facility: INRA
Clone: SGN-C183545 [TUS-42-H7] Trace: SGN-T196084 EST: SGN-E399375 Direction: 3' Facility: INRA
Clone: SGN-C183545 [TUS-42-H7] Trace: SGN-T200473 EST: SGN-E399594 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394759Length: 481 bp (853 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394759 [] (trimmed) GTTTTGAACCGACTGATATCTCTCTGTAGAGTCTCTCAACTCAGCGACGTCCGTTTTGATAAACTCAGAGACCCGGTTTCCATTTTCTCCACCTC
ACAAAATCAGGTAACATGGCGATCTTATTCCGAAGCTTCTCAGCCAACTCCGATAAATCCTCCACCACCACCTCCTCCATCCCCTAATACTTCTA
CAACAACTTCAAGTTCTCTCAATGAATTTGAACTTGCCAAATTCTCTGCCATTGCCGAAACCTGGTGGGATGCAGAAGGACCCTTTAAGCCATTA
CATCTGATGAACCCTACAAGACTTGCTTTTATTAGGTCCACTCTTTGTCGGCACTTCAGAAAGGATCCAAATTGCACTAGACCTTTTGAAGGACT
GAAGTTTGTTGATGTTGGTTGTGGAGGCGGAATTTTATCTGAGCCTTTGGCTCGAATGGGAGCTACGGTCACGGGAATTGATGCTGTGGAACAAA
ATATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394759] SGN-U564286 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196085 [Download][View] Facility Assigned ID: FA0AAD30CD04RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0041 Quality Trim Threshold: 14.5