EST details — SGN-E394746

Search information 
Request: 394746Match: SGN-E394746
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183453Clone name: TUS-42-D11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183453 is on microarray TOM1 spot ID 1-1-6.4.1.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C32452 [cLEG-1-K19] Trace: SGN-T64379 EST: SGN-E248316 Direction: 5' Facility: TIGR
Clone: SGN-C183453 [TUS-42-D11] Trace: SGN-T199428 EST: SGN-E398102 Direction: 3' Facility: INRA
Clone: SGN-C183453 [TUS-42-D11] Trace: SGN-T199428 EST: SGN-E399350 Direction: 3' Facility: INRA
Clone: SGN-C183453 [TUS-42-D11] Trace: SGN-T200342 EST: SGN-E399351 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394746Length: 204 bp (901 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394746 [] (trimmed) CAATTAGGTCGTGCCCTTAATGAGAAAATTTGCAAGAAATGCCTGGAACTTGATGTTGAGTTACTCATTGATGCTGAAGATACAGCCCCTCAACC
AGCGATTGATTACTTAGCATATTCAGCGGCAATTAAGTATCACAAAGAGGATCATCCTTTGTTATTTGGAACAATTCAAGCTTACTTAAAAGACT
CAAAAGAACGTATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394746] SGN-U578070 Tomato 200607 Build 2 64 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196072 [Download][View] Facility Assigned ID: FA0AAD30CB06RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0155 Quality Trim Threshold: 14.5