EST details — SGN-E394673

Search information 
Request: 394673Match: SGN-E394673
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183372Clone name: TUS-42-A2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183372 is on microarray TOM1 spot ID 1-1-7.1.2.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C4127 [cLEC-23-K12] Trace: SGN-T28429 EST: SGN-E206470 Direction: 5' Facility: TIGR
Clone: SGN-C183372 [TUS-42-A2] Trace: SGN-T1757 EST: SGN-E378616 Direction: 5' Facility: Giov. Lab
Clone: SGN-C183372 [TUS-42-A2] Trace: SGN-T195002 EST: SGN-E393676 Direction: 5' Facility: INRA
Clone: SGN-C183372 [TUS-42-A2] Trace: SGN-T195977 EST: SGN-E394651 Direction: 3' Facility: INRA
Clone: SGN-C183372 [TUS-42-A2] Trace: SGN-T195999 EST: SGN-E399211 Direction: 5' Facility: INRA
Clone: SGN-C183372 [TUS-42-A2] Trace: SGN-T200265 EST: SGN-E399210 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394673Length: 709 bp (859 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394673 [] (trimmed) AGGTAACTTGACTTTATTGATAATGTTTATTCCATACTACAAACAAGTACAACATGATATTTGAACTCACGAGCGAGCAACAAAAAGACATAAAG
ATAGGGGTAAGACTACTAATACAACAAATTCTTTTCACACTCCACGTGTGAAATTTATACTGACTATGTTATGATTGTCTTCAACACTTCATCCA
TAGCAAATCGTCAAATTCACCCTTTAACTTCTCTCCTACTAGTACGCTTCGTTCTGTTTCCCCTGCAGTAGTCTCCATAGGCATAGTCGAGGGGT
GCCAAGCTGGAGTTCCATTCTCATATCCATTACACGTCAATCGTCTCAATCCACTCCCATCCAGTTTCACCACATATAAATCACCATACGGCTGA
AACTGATTTGGCAACGACACTGGTTCTGCTGTCACTCCGCTCAAATTGCCCGTAAACAAGAGCCATTCACTGTCCTTACTGAAACATACATGATT
CAATCTCTCTTTATCCACTTCCTCTGATCCCTCCGGCCCTGCCACATATATCCTCCGAAGCCCTGATCCATCTGGATGAACAACGTAGATGCTAA
AACGATTAATGTCATTCGGATTATGCCTATTCGAAGAAAATGCAATTAGTTTTCCATCAGGTGACCAATTTGGCATCGTATCAATCCATGCCCCA
TTCGTTAACTGACGAACTTCTCCCCCTTCCATTTCTCCATTGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394673] SGN-U584580 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195999 [Download][View] Facility Assigned ID: FA0AAD30BA01RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0023 Quality Trim Threshold: 14.5