Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E394487

Search information 
Request: 394487Match: SGN-E394487
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183077Clone name: TUS-41-D19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183077 is on microarray TOM1 spot ID 1-1-6.4.3.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C67885 [cLEN-21-O8] Trace: SGN-T91559 EST: SGN-E276300 Direction: 5' Facility: TIGR
Clone: SGN-C183077 [TUS-41-D19] Trace: SGN-T195174 EST: SGN-E393848 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394487Length: 272 bp (874 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E394487 [] (trimmed) CTAGAGTTGAGGAGAGTTATGACAAAATGAGTGAATTAAAAGCGTTTGATGATACTAAGGCCGGTGTTAAAGGACTTGTTGATTCTGGAATTACT
AAAGTACCTCAAATATTCGTTCTACCGCCAAAAGACAGGGCTAAAAAATGTGAAACACATTTCGTTTTTCCAGTGATAGACCTTCAAGGTATCGA
TGAGGATCCGATTAAGCATAAGGAGATAGTGGACAAAGTTCGAGATGCATCGGACAAATGGGGTTTTTTCGGAGGGGATAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394487] SGN-U578448 Tomato 200607 Build 2 590 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195813 [Download][View] Facility Assigned ID: FA0AAD29CB10FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0036 Quality Trim Threshold: 14.5