EST details — SGN-E394460

Search information 
Request: 394460Match: SGN-E394460
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172766Clone name: TUS-14-G4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172766 is on microarray TOM1 spot ID 1-1-5.3.20.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10915 [cLEC-6-K12] Trace: SGN-T23969 EST: SGN-E202308 Direction: 5' Facility: TIGR
Clone: SGN-C172766 [TUS-14-G4] Trace: SGN-T195672 EST: SGN-E394346 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394460Length: 172 bp (875 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E394460 [] (trimmed) GGGCCCCCCCCCCGCAAATTTGTTTTTTTGTTTTAGATGCCTGTCGTCCTTCATAGATGGCCCAAACCACCAAAGACTGTCCCCTATGACAGTCT
CCTGCAGCAAACACCCCCTCCACACTAGTTGAGAAGCGTCCATAATCAGCCTTGAAGTTGGCCCTGTTGTCCTTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394460] SGN-U575484 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195786 [Download][View] Facility Assigned ID: FA0AAD2BD02FM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0346 Quality Trim Threshold: 14.5