EST details — SGN-E394380

Search information 
Request: 394380Match: SGN-E394380
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172970Clone name: TUS-14-O16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172970 is on microarray TOM1 spot ID 1-1-1.3.20.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14388 [cLEC-7-M10] Trace: SGN-T25435 EST: SGN-E202153 Direction: 5' Facility: TIGR
Clone: SGN-C172970 [TUS-14-O16] Trace: SGN-T195263 EST: SGN-E393937 Direction: 3' Facility: INRA
Clone: SGN-C172970 [TUS-14-O16] Trace: SGN-T195412 EST: SGN-E394086 Direction: 5' Facility: INRA
Clone: SGN-C172970 [TUS-14-O16] Trace: SGN-T195705 EST: SGN-E394379 Direction: 3' Facility: INRA
Clone: SGN-C172970 [TUS-14-O16] Trace: SGN-T195705 EST: SGN-E399106 Direction: 3' Facility: INRA
Clone: SGN-C172970 [TUS-14-O16] Trace: SGN-T195706 EST: SGN-E399107 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394380Length: 592 bp (860 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394380 [] (trimmed) TTTTTTAATCCTCAAAAGGCCATTAGTGCAAAAACATCTTAGCCCAATCACAATGTTCATTCATATGGCTTCTCCAATGAGGCCCAAACCATATC
AAGTACAAAGCCCAAAAGGCCTAAAAGATTATTCAAGGAACGACCAAAACTAAAATCTACTTTCTTCCATAAAAGTTTCGAAATAGAAATAAATC
AAAATAAAATAGCCAAAGTTAACACAATGACTTTCATCTTGAAGACTCTTATTCATCATCCCCTTACCAATTTATCATCACCACCACAACCATAC
TCACTTATCTAGGAAAAACTAATATTTCTCATAATCCTTGCTTAGAAAACTATAATTACATTCAAGCATCAGCAATTTCAGCTTCATCAGCTGCA
GCCAACATAAGCTCCGGGAGGACGCTTGTTTCTGCAGTTCCATCAAGGGCGTTGGGCAATCCCAACGCTCGTAGGGCGAGGTGAGCTGCCTTCTG
TCCTGATATCATCATAGCTCCAAAAGTTGGACCCATTCGTGGTGCTCCATCAATTTCAGCAACTTCCATTCCTGTGACAATCATACCAGGTACGA
CCTCTCTGGTAAGTCTAACAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394380] SGN-U580030 Tomato 200607 Build 2 241 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195706 [Download][View] Facility Assigned ID: FA0AAD2BH08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0006 Quality Trim Threshold: 20.5