EST details — SGN-E394295

Search information 
Request: 394295Match: SGN-E394295
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183069Clone name: TUS-41-D11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183069 is on microarray TOM1 spot ID 1-1-6.4.3.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C67733 [cLEN-21-C9] Trace: SGN-T91410 EST: SGN-E276151 Direction: 5' Facility: TIGR
Clone: SGN-C183069 [TUS-41-D11] Trace: SGN-T195622 EST: SGN-E394296 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394295Length: 375 bp (873 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E394295 [] (trimmed) AAGGATAAATATATCGTTAGATTTCATTGCAGGATTCGGCGAACACAAGACAGCTCACGAGGCTTCCTCTCTGATGAAACAAAGTTCTTTAATTA
TACAAAAGTTTAATATTGCAAACTGCATCATCTTCAACTGTAAAACACAACCAAACGAGATAATCCTAATAAGCAAACTACCTGAGGTTCTAAAT
AAAGTTCAGTTCAGTCTCATGCTTTCTTTGAAATGAGATCCTCAATCAGGTCTGCAGCATCTTGAACGGTTGCAATACTCTGAGCACTGTCTTCT
TCTACCCAGATGCCAAATTCTTCCACAAGTCCCATGACAATCTCCACCGTATCAAGATAATCAGCACCAACCGCAGCAAACTTTGAATCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394295] SGN-U577765 Tomato 200607 Build 2 52 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195621 [Download][View] Facility Assigned ID: FA0AAD29CB06FM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0240 Quality Trim Threshold: 14.5