EST details — SGN-E394280

Search information 
Request: 394280Match: SGN-E394280
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172957Clone name: TUS-14-O3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172957 is on microarray TOM1 spot ID 1-1-6.3.20.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14362 [cLEC-7-K6] Trace: SGN-T25269 EST: SGN-E201987 Direction: 5' Facility: TIGR
Clone: SGN-C172957 [TUS-14-O3] Trace: SGN-T195151 EST: SGN-E393825 Direction: 3' Facility: INRA
Clone: SGN-C172957 [TUS-14-O3] Trace: SGN-T195327 EST: SGN-E394001 Direction: 3' Facility: INRA
Clone: SGN-C172957 [TUS-14-O3] Trace: SGN-T195327 EST: SGN-E398988 Direction: 3' Facility: INRA
Clone: SGN-C172957 [TUS-14-O3] Trace: SGN-T195328 EST: SGN-E394002 Direction: 5' Facility: INRA
Clone: SGN-C172957 [TUS-14-O3] Trace: SGN-T195606 EST: SGN-E398989 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394280Length: 483 bp (838 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394280 [] (trimmed) CCATAAAATTGAGTACTGAACTGTTAAAATAGTATTACAACAATAAATTTTTGGTGTCTGTTCTTGTTACATTACTCCCAAACAAAACTACTTCA
ACATTGATCTTCAAAATAAATAATTACATTTTATACCATATTAATGAATAATCAAACATACAAAAACTTTAATCCAAACCCTTGAAACTTTTCTT
CAATGATATGATTGAGTTTATCAATCATCTCTACAGTAAAATAATTCTTCCAATCCCCAATTTCCCCTCTACAAAAAAACACTTTATATGGCTCT
CCAGTTGAAAACTTTCCATTTGTATTCACCTCCAAATTTCTCAAATTCCCAAAGCTACACATTTTTAATATCTCATCCACCACTCTTGAATTTTC
TTCCTCTATGGAAAATGGGCATTCCAAAAATTTACCCAACCGTTTAAGTTGAATTTTTGGTTTCTTTTTGATTTCTTCAAACATTAAAAAAATTA
TTTTGTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394280] SGN-U567882 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195606 [Download][View] Facility Assigned ID: FA0AAD2AH02RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.886 Expected Error Rate: 0.0119 Quality Trim Threshold: 14.5